Hmdb loader
Identification
HMDB Protein ID HMDBP08254
Secondary Accession Numbers
  • 13966
Name Metallothionein-3
Synonyms
  1. GIF
  2. GIFB
  3. Growth inhibitory factor
  4. MT-3
  5. MT-III
  6. Metallothionein-III
Gene Name MT3
Protein Type Unknown
Biological Properties
General Function Involved in metal ion binding
Specific Function Binds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro
Pathways Not Available
Reactions Not Available
GO Classification
Function
ion binding
cation binding
metal ion binding
binding
Cellular Location Not Available
Gene Properties
Chromosome Location Chromosome:1
Locus 16q13
SNPs MT3
Gene Sequence
>207 bp
ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC
AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG
GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA
GCAGAGAAGTGCAGCTGCTGCCAGTGA
Protein Properties
Number of Residues 68
Molecular Weight 6926.9
Theoretical pI 4.5
Pfam Domain Function
Signals
  • None
Transmembrane Regions
  • None
Protein Sequence
>Metallothionein-3
MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE
AEKCSCCQ
GenBank ID Protein 15341818
UniProtKB/Swiss-Prot ID P25713
UniProtKB/Swiss-Prot Entry Name MT3_HUMAN
PDB IDs Not Available
GenBank Gene ID BC013081
GeneCard ID MT3
GenAtlas ID MT3
HGNC ID HGNC:7408
References
General References
  1. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [PubMed:15489334 ]
  2. Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47. [PubMed:1873033 ]
  3. Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7. [PubMed:1631128 ]
  4. Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50. [PubMed:1464312 ]
  5. Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7. [PubMed:8039715 ]
  6. Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45. [PubMed:7677777 ]